Table 2 MicroRNAs detected by sequencing and their target gene families predicted in cotton
Sequence (5'-3')* | Gh-miRNA | Total†| Leaf | -3 DPA | 0 DPA | +3 DPA | Number of targets | Target gene family description |
|---|---|---|---|---|---|---|---|---|
UUGACAGAAGAUAGAGAGCAC | 156/157 | 36.6 | 65.9 | 19.8 | 8.9 | 38.6 | 20 | Squamosa promoter-binding factors, Ser/Thr protein phosphatase |
UUUGGAUUGAAGGGAGCUCUA | 159 | 11 | 17.5 | 20.9 | 7.2 | 8.6 | 4 | Beta-ketoacyl-CoA synthase |
UGCCUGGCUCCCUGUAUGCCA | 160 | 5.5 | 27.1 | 0 | 1.3 | 0 | 5 | Auxin response factor (ARF) family |
UCGAUAAACCUCUGCAUCCAG | 162 | 0.6 | 2.2 | 0 | 0 | 0.3 | 4 | Allyl alcohol dehydrogenase |
UGGAGAAGCAGGGCACGUGCA | 164 | 7.9 | 22.7 | 1.1 | 3.4 | 5.1 | 2 | NAC domain transcription factors |
UCGGACCAGGCUUCAUUCCCC | 165/166 | 3,250.5 | 4,058.6 | 7,506.8 | 1,928.1 | 2,835.4 | 10 | Class III HD-Zip proteins |
UGAAGCUGCCAGCAUGAUCUCA | 167 | 232.9 | 107 | 22 | 176.2 | 330.5 | 7 | Auxin response factor (ARF) family, glycoprotease |
UGCUUGGUGCAGAUCGGGAC | 168 | 144.9 | 72.9 | 5.5 | 7.7 | 242.6 | 4 | Argonaute 1, F-box proteins |
CAGCCAAGGAUGACUUGCCGG | 169 | 0.8 | 4.4 | 0 | 0 | 0 | 11 | Heme activating protein (HAP2), CCAAT-binding transcription factors |
UGAUUGAGCCGUGCCAAUAUC | 170/171 | 26.7 | 132.3 | 3.3 | 0.4 | 1.4 | 8 | Hairy meristem/Scarecrow-like 6 transcription factors |
AGAAUCUUGAUGAUGCUGCAU | 172 | 51.3 | 193.9 | 15.4 | 8.5 | 20.5 | 21 | APETALA2, AHAP2-like factors, Target of EAT1 (TOE1) |
UGGACUGAAGGGAGCUCCCUC | 319 | 0.1 | 0.4 | 0 | 0 | 0 | 7 | TCP family transcription factors |
AAGCUCAGGAGGGAUAGCGCC | 390 | 8.1 | 15.3 | 0 | 11.1 | 5.6 | 11 | TAS3, leucine-rich repeat transmembrane protein kinase |
UCCAAAGGGAUCGCAUUGAUUU | 393 | 3.1 | 0.9 | 0 | 13.2 | 0.6 | 11 | Transport inhibitor response 1 (TIR-1) |
UUCCACAGCUUUCUUGAACUG | 396 | 1.4 | 6.1 | 0 | 0.9 | 0.2 | 31 | ATCHR12 transcriptional regulator, growth regulating factors (GRF) |
UCAUUGAGUGCAGCGUUGAUG | 397 | 0.1 | 0.4 | 0 | 0 | 0 | 13 | Laccase/copper ion binding proteins, diphenol oxidase |
UGCCAAAGGAGAUUUGCCCGG | 399 | 1.1 | 4.8 | 0 | 0 | 0.3 | 2 | MYB family transcription factor, TIR-1 |
AUGCACUGCCUCUUCCCUGGC | 408 | 0.1 | 0.4 | 0 | 0 | 0 | 10 | Blue copper proteins, uclacyanin 3 |
UGUGGGAGAGUUGGGCAAGAAU | 2948 | 3.4 | 10 | 0 | 1.7 | 2.1 | 5 | Sucrose synthase, glucose-methanol-choline (GMC) oxidoreductase |
UCUUGCCUACUCCACCCAUGCC | 472/482 | 6.2 | 31.4 | 0.0 | 0.0 | 0.2 | 9 | NBS-type resistance protein |
UGCAUUUGCACCUGCACCUUC | 530 | 1.9 | 9.6 | 0 | 0 | 0.2 | 5 | C2H2 transcription factors, bHLH family protein |
UGACAACGAGAGAGAGCACGU | 535 | 11.9 | 45.9 | 1.1 | 1.3 | 5.1 | 4 | Squamosa promoter-binding factors |
UUAGAUGACCAUCAACAAACA | 827 | 0.3 | 1.7 | 0 | 0 | 0 | 1 | Unknown |
UCUUGCUCAAAUGAGUAUUCUA | 828 | 0.1 | 0.4 | 0 | 0 | 0 | 7 | MYB family transcription factors |
GUUUCACGUCGGGUUCACCA | 894 | 26.8 | 38.9 | 55.1 | 32.4 | 16.2 | 4 | Responsive to dessication 20 |
UAUACCGUGCCCAUGACUGUAG | 2947 | 11.2 | 46.3 | 0 | 1.7 | 3.7 | 1 | Serine/threonine protein phosphatase |
ACUUUUGAACUGGAUUUGCCGA | 2949 | 5.7 | 8.3 | 0 | 6.8 | 5.1 | 6 | Endosomal protein |
UGGUGUGCAGGGGGUGGAAUA | 2950 | 0.8 | 3.9 | 0 | 0 | 0.2 | 5 | Gibberellin 3-hydroxylase/anthocyanidin synthase |
UUGGACAGAGUAAUCACGGUCG | GhmiRcand1 | 3,683.5 | 5,684 | 14,594.7 | 311.6 | 2,638.9 | 3 | NAC domain transcription factors |