Open Access

Conservation of long-range synteny and microsynteny between the genomes of two distantly related nematodes

  • DB Guiliano1,
  • N Hall2,
  • SJM Jones3,
  • LN Clark2,
  • CH Corton2,
  • BG Barrell2 and
  • ML Blaxter1Email author
Genome Biology20023:research0057.1

DOI: 10.1186/gb-2002-3-10-research0057

Received: 22 May 2002

Accepted: 22 August 2002

Published: 26 September 2002

Abstract

Background

Comparisons between the genomes of the closely related nematodes Caenorhabditis elegans and Caenorhabditis briggsae reveal high rates of rearrangement, with a bias towards within-chromosome events. To assess whether this pattern is true of nematodes in general, we have used genome sequence to compare two nematode species that last shared a common ancestor approximately 300 million years ago: the model C. elegans and the filarial parasite Brugia malayi.

Results

An 83 kb region flanking the gene for Bm-mif-1 (macrophage migration inhibitory factor, a B. malayi homolog of a human cytokine) was sequenced. When compared to the complete genome of C. elegans, evidence for conservation of long-range synteny and microsynteny was found. Potential C. elegans orthologs for II of the 12 protein-coding genes predicted in the B. malayi sequence were identified. Ten of these orthologs were located on chromosome I, with eight clustered in a 2.3 Mb region. While several, relatively local, intrachromosomal rearrangements have occurred, the order, composition, and configuration of two gene clusters, each containing three genes, was conserved. Comparison of B. malayi BAC-end genome survey sequence to C. elegans also revealed a bias towards intrachromosome rearrangements.

Conclusions

We suggest that intrachromosomal rearrangement is a major force driving chromosomal organization in nematodes, but is constrained by the interdigitation of functional elements of neighboring genes.

Background

All genomes encode conserved genes. The arrangement of these genes on chromosomal elements is determined by a balance between stochastic rearrangements and functional constraints. The level of conservation of gene order (synteny) and linkage between two genomes will depend on the relative contributions of inter- and intrachromosomal rearrangements. Whereas shared ancestry and functional constraints will increase conservation of linkage and synteny between taxa, rearrangement events will tend to randomize gene order over time. In the Metazoa, several gene clusters have been identified that remain linked because of functional constraints. These include the histone genes [1], the Hox gene clusters [2], the immunoglobulin cluster [3], and the major histocompatibility complex (MHC) [4], but most genes are believed to be free to move within the genome. The tempo of gene rearrangement varies between taxa [5,6]. Vertebrate chromosomes are mosaic structures containing large conserved segments that can reside in different linkage groups in different species. There is a surprising conservation of synteny between distantly related species (approximately 450 million years (Myr) divergence) [7]. However, some lineages, such as rodents, show more extensive rearrangement than others, such as teleosts.

In protostomes, comparative studies of the genomes of closely related dipterans (Drosophila sp. and Aedes aegypti [5,8]) and nematodes (Caenorhabditis elegans and C. briggsae [6,9]) revealed a high rate of rearrangement. Chromosome rearrangements between closely related Drosophila species are mainly large pericentric inversions that may be facilitated by flanking transposon sequences [10,11]. C. elegans and C. briggsae are closely related, with estimates of 25-120 Myr divergence based on sequence comparisons [6,12]. Two groups have attempted to assess genome rearrangement rates and modes in comparisons between these two species. Kent and Zahler [9] compared 8.1 megabases (Mb) of fragmentary C. briggsae sequence derived from sequenced cosmid clones to C. elegans and derived a mean syntenic fragment length of 8.6 klobases (kb), or approximately 1.8 genes (there is one gene per 5 kb in C. elegans) [13]. In contrast, Coghlan and Wolfe [6], comparing 12.9 Mb of C. briggsae cosmid-derived sequence, found a mean syntenic fragment length of 53 kb. The difference appears to be purely methodological, as Kent and Zahler analyzed a subset of the data of Coghlan and Wolfe, and probably derives from a more relaxed definition of matching genes and use of cosmid fingerprinting physical map information by the latter study [6]. Estimation of rates of intrachromosomal to between-chromosome rearrangements showed that both were very frequent (approximately fourfold greater than that observed in D. melanogaster). Again, repeat sequences were associated with rearrangement boundaries [6]. It remains to be established whether this high rate of rearrangement is peculiar to the Caenorhabditis lineage, or is a general feature of nematode genomes.

To address this question we have begun analysis of a third nematode genome, that of the human filarial parasite Brugia malayi, which is estimated to have last shared a common ancestor with C. elegans 300-500 Myr ago [14]. B. malayi has a genome size of 100 Mb [15] and a gene complement estimated to be similar to C. elegans [16], and is the subject of a mature, expressed sequence tag (EST)-based genome project [16,17]. Unlike C. elegans, which has five autosomes and an XX/Xo sex-determination system [18], B. malayi has four autosomes and an XX/XY system [19]. The small size of condensed nematode chromosomes has precluded accurate in situ analysis of conservation of gene order. We have therefore taken a sequence-based approach, and here compare an 83 kb region surrounding the B. malayi macrophage-migration-inhibitory factor 1 locus (Bm-mif-1), a B. malayi homolog of a vertebrate cytokine [20], to the C. elegans genome and have found evidence for conservation of linkage and microsynteny between these two distantly related nematodes. The general features of this comparison were confirmed using a survey of genome sequences from B. malayi.

Results

General sequence features of an 83 kb segment of the B. malayigenome

Two overlapping bacterial artificial chromosome clones (BACs) were isolated that spanned the Bm-mif-1 locus. The inserts of BMBAC01L03 and BMBAC01P19 were 28,757 base pairs (bp) and 64,685 bp, respectively, with 10,637 bp of overlap, yielding a contiguated sequence of 82,805 bp (Figure 1). AT content overall was 68.0%; exonic DNA had an AT content of 59.9% and intergenic and intronic DNA had AT contents of 69.3% and 70.4% respectively. The average predicted gene size was 4.7 kb (range 0.6-20 kb). The average distance between genes was 3.1 kb (range 0.3-10.5 kb), giving an average gene density of one gene per 6.9 kb. There was an average of 9.3 introns per gene, with an average intron length of 316 bp (range 48-2,767 bp). The C. elegans orthologs of the B. malayi genes (see below) had a mean length of 3.2 kb, with an average of 5.5 introns per gene (mean size of 142 bp). The B. malayi genes were longer as a result of increased mean length and number of introns. Comparison to C. elegans presumed orthologs (see below) showed that only 50% of C. elegans introns were conserved in B. malayi (29 of 56 introns), and 25% of B. malayi introns (29 of 107) were conserved in C. elegans (Table 1). Of the 12 predicted B. malayi genes, seven were tested and confirmed by cDNA-PCR, and alternatively spliced transcripts were identified for four. Five of the 12 genes had corresponding ESTs (Table 1).
Figure 1

The BMBAC01L03/BMBAC01P19 contig compared to the C. elegans genome. Genes are indicated by exon (box) and intron (bracket) structures. For each species, the direction of transcription of the genes is indicated by an arrow. The C. elegans gene structures are drawn to the same scale as the B. malayi contig. A, Match to B. malayi EST cluster BMC03169 [16]. Brugia EST (BMC) and Onchocerca volvulus (OVC) clusters are viewable in NemBase [39,60]. B, Highly similar to O. volvulus EST cluster OVC02481 [61]. C, Match to B. malayi EST cluster BMC00238. D, Match to B. malayi EST clusters BMC02055 and BMC01932. However, no ORF was identified, and it may not represent protein-coding sequence (see text for discussion). E, Match to B. malayi EST cluster BMC06334. F, Match to B. malayi EST cluster BMC00400. G, BMBAC01L03.1 and BMBAC01P19.7 are gene fragments. Percent identity was calculated on the alignable portion of the C. elegans ortholog. H, F13G3.9 (Ce-mif-3) is on C. elegans chromosome I. However, F13G3.9 is not the predicted ortholog of Bm-mif-1 and thus the relationship is indicated by a dashed arrow (see text). I, Percent identity was calculated for BMBAC01P19.3 and BMBAC01L03.4 only within the PWWP or dnaJ domains respectively. Homolog pairs are indicated by the colouring of the gene models.

Table 1

Genes predicted on the BMBAC01L03/BMBAC01P19 contig

B. malayi open reading frame

Predicted cDNA length (bp)

Predicted peptide length

Number of introns

C. elegans ortholog

Percent identity with C. elegans ortholog

Number of introns in C. elegans ortholog

Number of shared intron positions with C. elegans ortholog

Putative identity

BMBAC01L03.1

1340*

446*

7*

CeF14B4.3

58

3

3

Amino-terminal fragment of the β subunit of RNA polymerase I

BMBAC01L03.2

693

230

6

CeF43G9.5

68

3

1

Pre-mRNA cleavage factor

BMBAC01L03.3

1239

412

8

-

-

-

-

Contains LON-ATP-dependent serine protease domain

BMBAC01L03.4

630

209

2

CeF39B2.10

57§

3

1

Contains dnaJ domain

BMBAC01L03.5

918

305

6

CeF43G9.3

58

6

2

Mitochondrial carrier protein

BMBAC01P19.1 (Bm-mif-1)

535

115

2

CeY56A3A.3

41

2

2

Macrophage-migration- inhibitory factor homolog

BMBAC01P19.2a/b (Bm-pbr-1)

5955/5748

1934/1865

37/35

CeC26C6.1

34

14

9

Polybromo domain protein, BAF180 homolog

BMBAC01P19.3 a/b

1182/919

367/283

9/7

CeF43G9.4

44

8

2

Contains PWWP domain

BMBAC01P19.4 (Bm-dap-1)

446

111

1

CeT28F4.5

30

1

1

Homolog of mammalian death- associated protein DAP-1

BMBAC01P19.5a/b (Bm-ubr-1)

2679/2602

847/821

18/17

CeT28F4.4

27

12

5

Unknown

BMBAC01P19.6

804

190

4

CeF31C3.5

41

1

1

Conserved protein of unknown function

BMBAC01P19.7a/b

1039/932*

274/298*

6/7*

CeC36B1.12

60#

3

2

Carboxy-terminal fragment of a novel transmembrane protein

*Gene fragments (see text). BMBAC01L03.1 gene fragment aligned with the amino-terminal 450 amino acids of CeF14B4.3. Number of introns in the aligned portion of the C. elegans ortholog. §Percent identity over the dnaJ domains of BMBAC01L03.4 and CeF39B2.10. Percent identity over the PWWP domains of BMBAC01P19.3 and CeF43G9.4. #The gene fragment of BMBAC01P19.7 aligned with the carboxy-terminal 380 amino acids of CeC36B1.12.

Comparison of predicted genes to C. elegans

All 12 predicted genes had C. elegans homologs, but putative orthology could only be assigned to 11 pairs (Figure 1, Table 1). Orthology definition is possibly problematic, as the complete genome sequence of B. malayi is not known, and it is thus possible that genes more similar to these C. elegans comparators could be present. We note, however, that no B. malayi EST-defined genes (23,000 ESTs defining approximately 8,300 genes [16]) have better matches to these C. elegans proteins (data not shown), and that orthology definition included coextension of the proteins, and conservation of intron position and phase (Table 1). The exception, BMBAC01L03.3, contained two domains, an amino-terminal LON ATP-dependent serine protease domain (domain PF02190) and an anonymous carboxy-terminal domain (PFB022940). Proteins predicted from the Arabidopsis thaliana (AAC42255.1), Mus musculus (NP_067424), and Homo sapiens (XP_0421219) genomes share this architecture, but there are no C. elegans proteins that have both domains.

Some genes were similar to hypothetical, functionally uncharacterized genes from C. elegans. BMBAC01P19.7a/b had multiple predicted transmembrane segments also found in a number of peptides from other species (PFB002843) and were most similar to C36B1.12 (60% identity). There is only one homolog of BMBAC01P19.3a in any organism -F43G9.4 from C. elegans. The amino termini of both BMBAC01P19.3a and F43G9.4 contained PWWP domains (PF00855). PWWP domains are found in proteins with nuclear location and roles in cell growth and differentiation [21,22]. PSORT profiling indicated that BMBAC01P19.3 and F43G9.4 were likely to have nuclear localizations. The amino terminus of BMBAC01L03.4 contains a dnaJ-like domain (PF00684). The dnaJ domain is found in 41 C. elegans proteins, but BMBAC01L03.4 showed highest identity (57%) to F39B2.10. Both proteins had the dnaJ domain at their amino terminus and shared a common position of the first intron in this region. The remainder of the protein was not conserved.

BMBAC01P19.1 encodes Bm-mif-1 (Figure 2) [20]. Mammalian MIF is a cytokine involved in inflammation, growth, and differentiation of immune cells [23]: B. malayi MIF-1 may have a role in immunomodulation of the host [20,24]. C. elegans has four MIF-like genes: Ce-mif-1 (Y56A3A.3), Ce-mif-2 (C52E4.2), Ce-mif-3 (F13G3.9), and Ce-mif-4 (Y73B6BL.13). Transgenic reporter and immunolocalization studies suggest that C. elegans MIFs may have roles in development and the dauer stage [13,25]. Bm-MIF-1 has highest pairwise similarity to Ce-MIF-1 (41% compared to 23-29% for the other three paralogues; Figure 2) [20], and phylogenetic analysis of over seventy MIF-like proteins from eukaryotes confirms this assignment (D.B.G. and M.L.B., manuscript in preparation). Comparison of Bm-MIF-1 to the C. elegans MIFs, a second B. malayi MIF (Bm-MIF-2), and human MIF-1 (Figure 2) revealed that Bm-mif-1 and Ce-mif-1 shared two intron/exon boundaries also found in vertebrate MIFs. One of these introns was also present in Ce-mif-3, but Ce-mif-3 and the other two C. elegans mif genes shared a set of introns not present in the mif-1 genes. Bm-MIF-1 and other filarial MIF-1 homologs contain a CXXC motif (single-letter amino-acid code) critical for the thiol-oxidoreductase activities of vertebrate MIF [26]. None of the C. elegans MIF homologs contained this motif.
Figure 2

Comparison of B. malayi and C. elegans MIF proteins. Bm-MIF-1 (accession AAC82502) was aligned with human Hs-MIF-1(AAA21814), C. elegans MIF homologs Ce-MIF-1 (CAB60512), Ce-MIF-2 (CAB01412), Ce-MIF-3 (CAA95795), Ce-MIF-4 (AAG23475), and Bm-MIF-2b (AAF91074). Intron positions are marked by triangles (red, conserved with Hs-MIF-1; blue, Ce-MIF-2, -3 and -4 specific). The proline at position 2 (white) is important for immune function, and the CXXC motif at positions 60-63 is essential for thiol-oxidoreductase activity in mammalian MIF. The percent identity of each protein to Bm-MIF-1 is given at the end of the alignment.

Conserved gene clusters

Two clusters of three genes in close proximity are conserved. The first involves BMBAC01L03.2, .3 and .5. The C. elegans orthologs of these genes are F43G9.5, F43G9.4, and F43G9.3 respectively. F43G9.5 and F43G9.3 are divergently transcribed from a 631 bp intergenic region. F43G9.3 is followed by F43G9.4 in the same transcriptional orientation with 501 bp separating the genes. In B. malayi this local synteny is conserved, except that two additional genes - BMBAC01L03.3 and .4 - are found between BMBAC01L03.2 and .5.

The second cluster also involves three genes. Proteins predicted from both alternative transcripts of BMBAC01P19.2 were found to be homologous to large proteins from Homo sapiens (BAF180, AAG34760 [27]), Gallus gallus (JC5056 [28]), D. melanogaster (CG11375, AAF56339), and C. elegans (C26C6.1) (Figure 3). These proteins shared six bromodomains (PF00439), two BAH domains (bromo-adjacent homology, PF01426), a HMG box (high mobility group, PF00505), and an anonymous carboxy-terminal domain (PFB007669). The B. malayi, C. elegans, and D. melanogaster polybromodomain (PBR) proteins also contain two C2H2 zinc fingers. PBR proteins may be involved in chromatin-remodeling complexes. Bromodomains interact with acetylated lysine in histone complexes, while HMG boxes are found in chromatin proteins that bind to single-stranded DNA and unwind double-stranded DNA. Human BAF180 has been shown to localize to the kinetochores of mitotic chromosomes [27]. None of the vertebrate PBR homologs contains zinc fingers, which may indicate additional functions for the nematode and fly proteins.
Figure 3

The pbr synteny cluster and pbr homologs in other species. The genomic organization of the pbr synteny cluster in C. elegans and B. malayi, and the domain structure of the PBR homologs in Drosophila melanogaster, Gallus gallus, and Homo sapiens are illustrated. Intron/exon boundaries that are conserved between the nematodes are indicated by asterisks. White boxes represent the contiguous DNA underlying the gene models.

Two conserved genes were identified immediately upstream from pbr-1 (Figure 3). BMBAC01P19.5 (named Bm-ubr-1 (upstream of pbr-1)) showed significant similarity only to T28F4.4 from C. elegans (27% identity). The protein encoded by BMBAC01P19.4 is homologous to C. elegans T28F4.5 (30% identity). Iterative searches of GenBank using PSI-BLAST [29] indicated that BMBAC01P19.4 and T28F4.5 belong to a group of small peptides that include human DAP-1 (death-associated protein). DAP-1 is a nuclear protein and positive regulator of interferon gamma-induced apoptosis in HeLa cells [30]. PSORT profiling indicated that both nematode proteins may have a nuclear localization. BMBAC01P19.2 (Bm-pbr-1) and BMBAC01P19.5 (Bm-ubr-1) are divergently transcribed and BMABAC01P19.4 (Bm-dap-1) is found in the large third intron of BMBAC01P19.5 in the same transcriptional orientation as BMBAC01P19.2 (Figure 3). In the C. elegans instance of the PBR cluster, C26C6.1 (Ce-pbr-1) and T28F4.4 (Ce-ubr-1) are also divergently transcribed from a 1,233 bp intergenic region. The third gene, T28F4.5 (Ce-dap-1) is found in the large third intron of T28F4.4 on the same strand as C26C6.1.

Comparison of the intergenic and upstream regions of both clusters, and of the orthologous gene pairs, did not reveal any clear motifs that might be involved in transcriptional regulation. In particular, the intergenic DNA between pbr-1 and ubr-1, and the first intron of ubr-1, had less than 30% pairwise identity throughout, and there were no stretches of greater identity. The AT richness of the B. malayi genome compared to C. elegans may obscure any conserved elements. No RNA-coding genes were found. Two B. malayi ESTs matched at > 99.5% identity to two regions of BMBAC01P19 separated by 200 bp that were not predicted to be part of a transcript (see Figure 1). These regions are downstream of gene BMBAC01P19.3, and may derive from alternative 3' untranslated regions: the furthest downstream match includes a good polyadenylation site. The 3' end of the cDNA determined for this gene may have derived from internal priming from an A-rich segment of the 3' untranslated region.

Fractured synteny between the genomes of B. malayi and C. elegans

All of the C. elegans orthologs, except for Y56A3A.3 (Ce-mif-1, 41% identity to Bm-mif-1, on chromosome III), are located on chromosome I (Figure 4). F13G3.9 (Ce-mif-3, 23% identity to Bm-mif-1) is found on C. elegans chromosome I in close proximity to the orthologs of B. malayi genes BMBAC01P19.2, .4, and .5. This could suggest that our orthology assignment is wrong. As described above, however, Ce-mif-1 and Bm-mif-1 share two intron positions and are more similar to each other than either is to Ce-mif-3, which has one concordant intron position, and one discordant intron position. The conflict between location and structure could be due to a gene-conversion event in either lineage, or an event of directed movement or insertion.
Figure 4

Comparison of linkage and synteny with C. elegans. The B. malayi contig is compared to an approximately 9 Mb segment of C. elegans chromosome I. The relative positions of the ortholog pairs, colored as in Figure 1, are indicated. The link between Bm-mif-1 and Ce-mif-3 (F13G3.9) is dashed to indicate that these two genes are paralogs rather than orthologs (see text for details).

Eight of the 10 remaining C. elegans orthologs lay within a 2.3 Mb region in the center of chromosome I (6.7-9 Mb) (Figure 4). The orthologs of the other two genes (BMBACoLo3.4 and BMBAC01P19.6) are found at the distal tip of chromosome I. While there has been extensive rearrangement of gene order, when compared to the C. elegans orthologs, 10 of the B. malayi genes were in the same relative transcriptional orientation. Examination of the boundaries of the C. elegans cluster and individual gene regions did not show any association with repeat-sequence classes, including those shown to be commonly associated with rearrangements between C. elegans and C. briggsae [6].

Genome survey sequence comparison and synteny

To ascertain whether the segment sequenced was representative of the relationship between the B. malayi genome and that of C. elegans, we surveyed the B. malayi BAC-end derived genome survey sequences (GSSs; J. Daub, C. Whitton, N.H., M. Quail and M.L.B., unpublished observations). There are over 18,000 GSSs from B. malayi, derived from three independent libraries. Each BAC-end sequence was compared to the C. elegans proteome (Wormpep [31]) and significant similarities recorded (BLASTX probabilities < e-8). The chromosomal position of each matching C. elegans protein was derived from Wormbase [32]. One hundred and sixty-four BACs had matches at both ends to C. elegans proteins under these conditions (summarized in Table 2, details in Table 3). We note that these matches are not necessarily to orthologs, as we have not carried out intensive analysis of each one, but random selection of genes should not yield greater linkage estimation despite the problem of gene families and domain matches. While much of the C. elegans proteome consists of protein families, very few of these have a chromosomally restricted distribution [33,34].
Table 2

Synteny conservation between B. malayi BAC-end genome survey sequences and C. elegans genome sequence

Maximal probability of either of blast matches

Number of BACs with both ends matching C. elegans proteins

Number of BACs with both ends matching C. elegans proteins on the same chromosome

Distance between C. elegans proteins (megabases)

Percentage of matches on same chromosome

<e-8

164

90

4.4

54.88

<e-10

138

78

4.6

56.52

<e-15

51

29

4.7

56.86

<e-20

17

10

5.3

58.82

B. malayi BAC end sequences were compared to the C. elegans proteome using BLASTX. Matches with a probability <e-8 were noted, and chromosomal positions determined from WormBase. Of 2,200 BACs with matches, 164 had matches to both ends.

Table 3

B. malayi BAC end comparisons to C. elegans

 

T7 end

SP6 end

 

Brugia malayi BAC clone

C. elegans match

C. elegans chromosome

Position on chromosome

Exponent of probability in BLAST search

C. elegans match

C. elegans chromosome

Position on chromosome

Exponent of probability in BLAST search

Distance between matches

BMBAC01M03

CE27661

IV

7844080

18

CE03144

II

11592445

30

NA

BMBAC01I11

CE12826

II

2125627

24

CE27131

X

12434210

12

NA

BMBAC01O12

CE12384

IV

11536217

21

CE24899

X

10540216

13

NA

BMBAC01I15

CE07931

X

1138520

11

CE00450

III

7926986

9

NA

BMBAC01F17

CE06551

V

11711418

18

CE00946

III

4668338

18

NA

BMBAC01F18

CE06551

V

11711418

18

CE00946

III

4668338

18

NA

BMBAC03I06

CE04396

X

4702371

12

CE01008

III

3436926

17

NA

BMBAC03F12

CE22809

IV

10961452

9

CE28366

V

2688438

15

NA

BMBAC03O15

CE29604

I

10151104

24

CE08947

V

11984722

10

NA

BMBAC03F17

CE00316

III

9821062

22

CE14390

V

6500809

8

NA

BMBAC03J17

CE20445

IV

3562754

23

CE15856

II

13201660

9

NA

BMBAC04M12

CE14750

I

4619453

9

CE17599

V

14520036

11

NA

BMBAC04B14

CE26776

IV

2800306

36

CE03447

X

10583738

36

NA

BMBAC04B18

CE01099

III

9303554

45

CE16711

V

18449410

43

NA

BMBAC06B01

CE15044

V

4304442

23

CE26600

I

1494247

10

NA

BMBAC07G03

CE07756

II

3032776

9

CE13435

I

6135032

20

NA

BMBAC08D11

CE22116

II

14151234

16

CE17662

I

9188977

19

NA

BMBAC08E17

CE18356

I

3663582

17

CE24671

X

1800708

13

NA

BMBAC09F11

CE08682

I

4162592

13

CE08947

V

11984722

10

NA

BMBAC09K18

CE26381

IV

7210081

26

CE27040

III

1491791

12

NA

BMBAC09A22

CE24671

X

1800708

38

CE14734

II

1143941

33

NA

BMBAC10N08

CE14734

II

1143941

29

CE11078

X

14666566

18

NA

BMBAC11P11

CE18826

I

12580986

63

CE01074

III

4761237

39

NA

BMBAC301H09

CE00436

III

8966904

15

CE03397

II

10033351

10

NA

BMBAC303G12

CE25661

X

10088725

12

CE28910

IV

12096051

37

NA

BMBAC305D10

CE05811

IV

12222786

10

CE26022

I

13790068

13

NA

BMBAC306C12

CE19038

II

12001566

10

CE17716

V

5828441

25

NA

BMBAC307F09

CE26106

III

11214188

14

CE24397

I

398952

12

NA

BMBAC308B07

CE01495

III

4243241

9

CE23997

I

4301621

52

NA

BMBAC308E07

CE10254

V

8596497

16

CE22541

IV

1058851

39

NA

BMBAC309G05

CE19946

V

13652193

10

CE20405

I

10121170

21

NA

BMBAC310G03

CE00169

III

8560276

16

CE03487

IV

11101538

20

NA

BMBAC310F07

CE26106

III

11214188

20

CE17565

I

12897554

9

NA

BMBAC311D10

CE05492

IV

9045220

11

CE09323

I

8357446

11

NA

BMBAC312B12

CE03263

X

12785597

11

CE20461

II

11358344

28

NA

BMBAC314G02

CE04726

X

7500571

15

CE16564

III

10779508

14

NA

BMBAC314G05

CE04726

X

7500571

15

CE16564

III

10779508

14

NA

BMBAC314C06

CE14448

V

8303220

13

CE25695

III

7697801

23

NA

BMBAC321E09

CE00901

III

3777196

28

CE04196

IV

7171873

27

NA

BMBAC324A05

CE23883

X

10640426

10

CE24718

IV

9708837

15

NA

BMBAC325E11

CE24076

IV

16170439

27

CE20681

III

3942090

19

NA

BMBAC327E05

CE29377

II

14249402

21

CE05190

I

7147729

9

NA

BMBAC328H12

CE11268

I

6056251

27

CE20346

IV

359584

33

NA

BMBAC331C11

CE00639

III

10524644

12

CE07306

V

8110632

39

NA

BMBAC332H10

CE03812

X

11374102

41

CE03398

II

10030927

18

NA

BMBAC335D03

CE00713

III

6820989

37

CE26022

I

13790068

10

NA

BMBAC335B06

CE03657

X

12880838

36

CE28110

II

12072195

15

NA

BMBAC335H06

CE04374

III

7093735

29

CE27906

II

7218339

12

NA

BMBAC335B11

CE28095

II

6474361

11

CE12664

IV

10627077

9

NA

BMBAC335G11

CE14211

II

526662

12

CE00644

III

4417152

9

NA

BMBAC338H04

CE21000

I

3609203

39

CE01643

II

8066397

57

NA

BMBAC340C01

CE08947

V

11984722

12

CE06100

I

7963691

10

NA

BMBAC340H10

CE24671

X

1800708

28

CE28961

II

8518425

11

NA

BMBAC341A06

CE24422

II

15153828

10

CE26560

IV

2637785

14

NA

BMBAC341H09

CE20297

I

10962692

19

CE07462

X

16821321

18

NA

BMBAC342D11

CE27040

III

1491791

14

CE11074

X

14645097

11

NA

BMBAC352C10

CE00713

III

6820989

44

CE26022

I

13790068

18

NA

BMBAC353A03

CE00949

III

4694946

10

CE06100

I

7963691

18

NA

BMBAC353E06

CE09682

IV

17269732

48

CE02716

II

4609014

10

NA

BMBAC354G08

CE24000

X

13899761

16

CE21401

I

12747957

34

NA

BMBAC354C09

CE16562

III

10808992

23

CE17579

IV

1178045

9

NA

BMBAC355C03

CE04838

IV

7225306

12

CE21023

I

2496034

24

NA

BMBAC356B08

CE06116

V

10355247

11

CE26971

I

311402

14

NA

BMBAC357C02

CE14754

I

4624187

24

CE19593

III

867498

12

NA

BMBAC360E07

CE06034

IV

11733052

15

CE02044

II

6736839

11

NA

BMBAC362E03

CE05492

IV

9045220

11

CE28001

III

6020770

16

NA

BMBAC365D07

CE15463

IV

12871709

16

CE01508

II

11384821

12

NA

BMBAC365F09

CE15612

V

10250527

10

CE05747

IV

12401915

20

NA

BMBAC365D11

CE15892

I

13091093

13

CE28340

III

13328281

9

NA

BMBAC368B08

CE21026

X

8125574

15

CE09880

I

8898846

16

NA

BMBAC374G02

CE24292

II

12681620

11

CE06704

IV

5987165

18

NA

BMBAC375H10

CE01537

II

9588260

15

CE04726

X

7500571

15

NA

BMBAC376D04

CE02705

II

5918674

9

CE29504

IV

4212960

17

NA

BMBAC377D05

CE03061

X

12966730

14

CE15044

V

4304442

10

NA

BMBAC01G04

CE12942

II

163142

12

CE15754

II

13443071

19

13279929

BMBAC01J11

CE17559

III

3729721

13

CE27691

III

6439903

14

2710182

BMBAC01N16

CE19942

II

6157856

20

CE01090

II

7858336

15

1700480

BMBAC01A23

CE27862

I

4952222

8

CE16340

I

13239686

8

8287464

BMBAC01M24

CE02307

II

10222779

15

CE04813

II

4902586

25

5320193

BMBAC02F03

CE01008

III

3436926

30

CE02018

III

5268852

17

1831926

BMBAC02M10

CE18369

IV

14965985

26

CE27782

IV

32953

13

14933032

BMBAC03D10

CE01563

II

10146750

11

CE18563

II

14006392

10

3859642

BMBAC03L15

CE27488

IV

2976034

13

CE20122

IV

12679870

30

9703836

BMBAC03O17

CE27311

III

1616853

13

CE00946

III

4668338

20

3051485

BMBAC03J24

CE21971

II

12727192

17

CE22157

II

13670692

12

943500

BMBAC04P08

CE17474

IV

8034836

13

CE06702

IV

5987165

37

2047671

BMBAC04J10

CE17474

IV

8034836

12

CE06702

IV

5987165

35

2047671

BMBAC04G15

CE03492

III

10465212

14

CE01161

III

5016428

29

5448784

BMBAC04L18

CE26381

IV

7210081

23

CE06302

IV

10375062

23

3164981

BMBAC06H01

CE16413

V

11222884

11

CE08630

V

4818967

13

6403917

BMBAC07C02

CE13736

I

5616992

9

CE18454

I

7384257

27

1767265

BMBAC07C06

CE28324

X

4830732

21

CE23711

X

14708595

24

9877863

BMBAC07E21

CE16194

III

10818631

33

CE26632

III

12724299

46

1905668

BMBAC07C22

CE16565

III

10784128

12

CE17401

III

3778796

16

7005332

BMBAC08P03

CE27215

X

6626852

21

CE09403

X

4445872

16

2180980

BMBAC09E01

CE25011

III

7031238

12

CE24009

III

4722390

10

2308848

BMBAC09B17

CE25196

II

2913916

15

CE18730

II

11578670

11

8664754

BMBAC09E19

CE22045

III

11317051

12

CE20681

III

3942090

23

7374961

BMBAC09J20

CE27601

IV

3694675

13

CE17308

IV

3625656

9

69019

BMBAC09A24

CE04504

IV

8315582

37

CE29005

IV

6345808

12

1969774

BMBAC10M23

CE01473

II

8023190

13

CE28454

II

5867637

17

2155553

BMBAC11H08

CE11494

II

10872814

20

CE03412

II

11545610

17

672796

BMBAC11K08

CE28485

IV

16845895

21

CE06705

IV

5987165

45

10858730

BMBAC11C09

CE21401

I

12747957

12

CE08532

I

3704246

13

9043711

BMBAC11H20

CE08377

I

10117043

20

CE17566

I

12903800

16

2786757

BMBAC13A23

CE29235

II

6995861

10

CE23659

II

13251947

19

6256086

BMBAC301F09

CE28770

V

7400098

9

CE06116

V

10355247

13

2955149

BMBAC303H10

CE18123

X

10768551

12

CE04392

X

5627431

15

5141120

BMBAC303E12

CE01105

III

3992607

28

CE05066

III

6081444

39

2088837

BMBAC306B02

CE19437

IV

1935178

12

CE06634

IV

11985224

30

10050046

BMBAC306F02

CE21208

V

11417176

9

CE15044

V

4304442

46

7112734

BMBAC306B09

CE05594

IV

11574005

10

CE18268

IV

262009

12

11311996

BMBAC309A07

CE27186

II

1490131

20

CE20311

II

14794131

18

13304000

BMBAC309H07

CE15235

I

6586100

12

CE15751

I

8715988

13

2129888

BMBAC311C01

CE26713

X

10830672

11

CE05839

X

14719098

16

3888426

BMBAC312B02

CE23530

II

9886945

21

CE05732

II

9892692

9

5747

BMBAC318E08

CE03335

II

9006072

32

CE01731

II

10094778

33

1088706

BMBAC320B05

CE24687

I

13505250

32

CE10608

I

5535918

18

7969332

BMBAC321D05

CE03487

IV

11101538

12

CE06601

IV

12361570

12

1260032

BMBAC323H11

CE28173

II

7045967

12

CE03349

II

8811285

12

1765318

BMBAC326G05

CE18454

I

7384257

16

CE19979

I

14650506

17

7266249

BMBAC327F03

CE05372

I

8656418

20

CE17767

I

14934285

15

6277867

BMBAC327E08

CE22135

II

13280025

18

CE03397

II

10033351

14

3246674

BMBAC329E10

CE26424

III

7268168

10

CE26172

III

2584463

13

4683705

BMBAC333B09

CE06291

III

9853062

21

CE00018

III

9542362

18

310700

BMBAC335G07

CE23108

V

18907704

25

CE08145

V

7207535

24

11700169

BMBAC336F09

CE23823

V

904798

12

CE08939

V

10165831

10

9261033

BMBAC338B09

CE19930

IV

11494578

12

CE27358

IV

12787708

12

1293130

BMBAC339A05

CE03536

X

11156821

19

CE29169

X

15581083

10

4424262

BMBAC340B12

CE28433

V

12591291

11

CE06114

V

10352190

21

2239101

BMBAC341B01

CE06362

IV

11131027

28

CE17284

IV

507058

10

10623969

BMBAC344B10

CE27691

III

6439903

9

CE18868

III

13830997

16

7391094

BMBAC345G11

CE16052

III

13507164

17

CE01319

III

7408460

22

6098704

BMBAC346C07

CE20899

III

9066807

42

CE06204

III

10983239

9

1916432

BMBAC348D09

CE27859

X

4671617

13

CE03447

X

10583738

14

5912121

BMBAC349D02

CE28454

II

5867637

30

CE01473

II

8023190

15

2155553

BMBAC349A03

CE01694

II

9647841

22

CE01697

II

9649394

30

1553

BMBAC350E01

CE05839

X

14719098

31

CE28227

X

10830175

11

3888923

BMBAC350F06

CE07421

IV

7521267

17

CE17427

IV

606450

11

6914817

BMBAC351D02

CE17559

III

3729721

37

CE29455

III

7295192

14

3565471

BMBAC351E11

CE04813

II

4902586

15

CE01843

II

6318128

9

1415542

BMBAC352A02

CE16057

X

9835707

16

CE23711

X

14708595

13

4872888

BMBAC352H11

CE27011

III

2386289

22

CE23035

III

12323434

40

9937145

BMBAC354D02

CE09506

V

13767614

15

CE26193

V

7064763

11

6702851

BMBAC354C06

CE28000

V

5680455

19

CE18785

V

14010680

10

8330225

BMBAC357F01

CE07705

I

5160615

15

CE17689

I

7197186

12

2036571

BMBAC357D06

CE05481

V

9909478

10

CE18731

V

12911699

11

3002221

BMBAC360G09

CE26686

V

19889249

20

CE12204

V

12228547

13

7660702

BMBAC361F02

CE21971

II

12727192

15

CE24422

II

15153828

14

2426636

BMBAC364D04

CE19878

IV

13020730

47

CE12664

IV

10627077

24

2393653

BMBAC364D12

CE05066

III

6081444

36

CE01648

III

10372177

11

4290733

BMBAC365G04

CE27551

I

1567610

19

CE09340

I

9956916

15

8389306

BMBAC367E09

CE29511

III

7551909

19

CE28049

III

10232451

11

2680542

BMBAC369F08

CE20121

IV

12674275

12

CE06362

IV

11131027

44

1543248

BMBAC370D08

CE09762

IV

3867451

19

CE17122

IV

7994133

17

4126682

BMBAC372C01

CE06239

I

8521548

15

CE16055

I

10289506

13

1767958

BMBAC372A05

CE23035

III

12323434

18

CE27402

III

5842056

15

6481378

BMBAC372F06

CE29472

III

5231760

15

CE00100

III

8521627

9

3289867

BMBAC372A09

CE00872

III

4156692

10

CE20934

III

3133584

18

1023108

BMBAC373F04

CE09880

I

8898846

12

CE06511

I

7477616

19

1421230

BMBAC374E02

CE00946

III

4668338

10

CE03076

III

3936413

20

731925

BMBAC374F12

CE21847

IV

1757609

21

CE06364

IV

11128632

11

9371023

BMBAC375A04

CE25585

IV

6754827

12

CE04562

IV

7326282

11

571455

BMBAC375F12

CE22210

V

14353297

17

CE21224

V

7077544

16

7275753

Clones with significant matches at both ends. NA, not applicable.

C. elegans has six chromosomes. Under a minimal model, if a genome rearrangement were equally likely to involve a between-chromosome as a within-chromosome event, and was only dependent on the length of DNA in the within-chromosome versus not-within-chromosome classes, we would expect approximately five of every six rearrangements to involve between-chromosome events and one-sixth to involve within-chromosome events. This model ignores the fact that B. malayi has only five chromosome pairs: four autosomes and one XY pair. The derivation of the two karyotypes is unknown, and cannot be deduced from phylogenetic comparisons (see [35]). While most nematodes of clade V have six chromosomes like C. elegans, other taxa in the Secernentea have from one to > 100 [36]. If we assume that the C. elegans complement derives from splitting of an ancestral chromosome retained in B. malayi, the expectation would be that 20% of rearrangements would be within-chromosome.

Many more BACs had significantly more ends mapping to the same chromosome than would be expected under these models (approximately 55%, χ2 test p < 0.01 for all comparisons in Table 2 under the above model). The mean distance between the C. elegans matches was 4.4 Mb, which may be compared to an expected approximately 45 kb for the separation between the B. malayi BAC ends.

Discussion

B. malayi is a human parasite only distantly related to the model nematode C. elegans [14,37]; therefore, genome comparisons between these species will yield data concerning longer-term changes in structure and function that cannot be derived from within-genus comparisons. In the 83 kb of genomic DNA flanking the B. malayi mif-1 locus we found a fractured conservation of microsynteny between the two nematode genomes, and conservation of linkage. Twelve protein-coding genes were predicted, and 11 of these had putative orthologs in the C. elegans genome. Ten of these orthologs were on C. elegans chromosome I, with eight in a 2.3 Mb segment in the center of the chromosome and two at the distal tip of chromosome I. Some of these genes have remained tightly linked in the same or slightly modified relative transcriptional orientations in both species.

This pattern, of conservation of linkage with disruption of precise synteny, was confirmed using BAC-end sequences. Of the 171 clones with matches at both ends to C. elegans genes, over 55% were localized to the same chromosome in C. elegans. While the mean distance separating the B. malayi genes is 45 kb (the length of the BAC clones; [38] and C. Whitton and M.L.B., unpublished work), the mean distance between the matching C. elegans genes is approximately 4.4 Mb.

The 83 kb fragment of B. malayi genomic DNA is the largest contiguated portion of sequenced genomic DNA from a non-rhabditid nematode described to date. A large proportion (around 60%) of genes identified in the B. malayi EST dataset (23,000 ESTs corresponding to around 8,300 unique transcripts [39]) have no close C. elegans homologue [16]. In this study, however, C. elegans orthologs were identified for 11 of the 12 identified B. malayi genes. Some of these orthologous pairs were confirmed by congruence in length of open reading frame and shared intron positions, despite low pairwise identity. Global searches with ESTs would not have detected these pairs (BLAST probability values of approximately e-4), and thus the true proportion of B. malayi unique genes is likely to be less than 60%. B. malayi genes were found to have larger and more numerous introns than C. elegans genes (2.2 times longer and 1.7 times more frequent), in keeping with previous estimates made using data from several highly expressed genes [40]. If the contig is representative and gene complement is equivalent to C. elegans, the B. malayi genome may be larger (120-140 Mb) than estimated previously (100 Mb [41]). Four of seven genes confirmed by reverse transcriptase PCR had alternative transcripts, a figure consistent with C. elegans EST and cDNA projects [42]. Additionally, five genes had B. malayi EST matches, a proportion congruent with the estimate that the EST program has identified around 40% of the expected 20,000 B. malayi genes [16].

Conserved linkage between the genomes of closely related eukaryotic organisms has been shown in several taxa. But it is only recently, with the sequencing of discrete segments or whole genomes, that examples of conservation of microsynteny between the genomes of distantly related species (not involving functionally related genes) have been described [43,44]. The microsyntenic gene clusters retained between C. elegans and B. malayi do not fall into any clear functional categories. However, all genes contained in the second cluster (BMBAC01P19.2, .4, and .5) are predicted to have nuclear localization signals and could be co-regulated. Alternatively, promoters or cis-acting regulatory elements required for their proper function could be embedded within other cluster members. Interdigitation of these regulatory elements could be constraining the movement of genes away from this cluster. No conserved motifs were found, however, and this possibility can thus only be tested by transgenesis experiments. This phenomenon has been observed in other systems such as fungal genomes, where gene pairs predicted to have overlapping regulatory elements are more likely to be conserved between species [45].

Many genes in C. elegans are co-transcribed in operons [46,47] and this could constrain synteny breakage. The C. elegans orthologs of BMBAC01L03.5 and BMBAC01P19.3 are separated by 501 bp, an intergenic distance found in other C. elegans operons, and the downstream gene (Ce-F43G9.4) was shown to be trans-spliced to the SL2 spliced leader, a feature of downstream genes in C. elegans operons [47]. However, in B. malayi, BMBAC01L03.5 and BMBAC01P19.3 are separated by 2.8 kb, which is outside the range of operon intergenic spacing. The functions of C. elegans genes on chromosome I have been investigated by RNA-mediated interference and a phenotype was identified for one gene in each cluster: embryonic lethality (F39G4.5 [48]) and altered adult morphology (C26C6.1 [49]). Therefore, it is possible that the clusters are conserved because removing other members would interfere with functions of these essential genes. The one exception to the conservation of linkage is the Bm-mif-1/Ce-mif-1 ortholog pair. Another C. elegans MIF homolog, Ce-mif-3, is found in close proximity to the genes in the pbr-1 synteny cluster, raising the possibility that a gene-conversion event may have obscured orthology assignment for this gene.

In the Metazoa, long-range synteny between the genomes of distantly related species (>300 Myr divergence) has only been identified previously in vertebrates (teleost fish and humans [50,51]). In vertebrates, interchromosomal exchanges seem to be rare events, and some linkage groups, such as human chromosomes 6 and X, are conserved across most eutherian mammals [7]. From the analyses presented here we can suggest some general patterns of gene rearrangement in nematodes. Most of the C. elegans orthologs were located in a small segment of chromosome I (nine of eleven genes in 2.3 Mb or 16% of the chromosome), suggesting that local intrachromosomal inversions or rearrangements have occurred more frequently than long-range intrachromosomal, or interchromosomal rearrangements. This is consistent with patterns observed in closely related dipterans, where the composition of linkage groups is conserved but not the order within the chromosome. Mechanistically this may occur because intrachromosomal rearrangements require fewer DNA breaks than interchromosomal translocations, and the nuclear scaffold may hold local chromosomal regions in closer association. The high rate of rearrangement of genes within the nematode chromosomes makes it unlikely that the positional information of genes in the Caenorhabditis genomes will be useful in finding orthologous genes in the genomes of distantly related nematodes such as B. malayi.

Materials and methods

Identification of candidate genomic clones for sequencing

A probe for Bm-mif-1 was synthesized by labeling full-length cDNA (GenBank accession U88035) with biotin (Phototope; New England Biolabs), hybridized to high-density arrays of 18,000 BAC clones containing B. malayi genomic DNA [52], and detected with the Phototope detection kit (New England Biolabs). Hybridization-positive BACs were PCR verified using gene-specific primers Bm-MIF-1.F1a (ATGCCATATTTTACGATTGATAC) and Bm-MIF-1.R1a (GAACACCATCGCTTGTCCACC) using standard reaction and cycling conditions (0.2 mM dNTPs, 1.5 mM MgCl, 0.5 pM primer; 1 cycle of 94°C for 3 min; 35 cycles of 94°C for 15 sec, 55°C for 20 sec, 72°C for 3 min; 1 cycle of 72°C for 10 min). BMBAC01P19 was selected for sequencing. Sequence from the T7 end of the insert was used to design specific primers 01P19.T7.F1 (GCAGCAAATGCTTATTTGTCTTG) and 01P19.T7.R1 (GTTTGGTGATTCATGTCCATGAGC). Primers 01P19.T7.R1 and 2BiotinBACF3 (designed to the BAC vector; (biotinU)2GAGTCGACCTGCAGGCATGC; New England BioLabs Organic Synthesis Unit) were used to synthesize a biotin-labeled end probe. The probe was hybridized to the BAC library filter using a modified hybridization and detection protocol [38]. Positive BACs were PCR verified with primers 01P19.T7.R1 and 01P19.T7.F1, and insert DNA prepared using a kit (Qiagen). BAC ends were end-sequenced using the Sanger Institute protocol [53]. BMBAC01L03 showed minimal overlap with BMBAC01P19 compared to other clones and was selected for sequencing.

Preparation, subcloning, and sequencing of BACs

The BACs were sequenced using a standard two-stage strategy involving random sequencing of subcloned DNA followed by directed sequencing to resolve problem areas. In the first stage, DNA prepared from BAC clones was shattered by sonification and fragments of 1.4-2 kb cloned into pUC18. DNA from randomly selected clones was sequenced with dye-terminator chemistry and analyzed on automated sequencers. Each BAC was sequenced to a depth of sevenfold coverage. Contigs were assembled using phrap (Phil Green, Washington University Genome Sequencing Center, unpublished). Manual base calling and finishing was carried out using Gap4 [54]. Gaps and low-quality regions were resolved by techniques such as primer walking, PCR and resequencing clones under conditions that give increased read lengths.

Sequence analysis

The finished sequences of BMBAC01P19 and BMBAC01L03 were compared to the GenBank nonredundant (nucleic acid and protein) EST database (dbEST), the C. elegans genome and protein and the custom B. malayi clustered EST [16] databases using BLAST [55,56]. GeneFinder (P. Green and L. Hillier, Washington University Genome Sequencing Center, unpublished) was trained with 162 publicly available B. malayi gene sequences and used to analyze the contiguated sequence. The sequence was annotated on the Artemis workbench [57]. Predicted protein sequences were compared to Pfam [58] and cellular localization examined using PSORTII [59]. The annotated sequence is available in GenBank (accession AL606837).

Verification of gene predictions

To confirm gene predictions from BMBAC01P19, primers were designed and PCR was carried out on oligo(dT)-primed B. malayi mixed adult first-strand cDNA with gene-specific primers. To isolate cDNA ends, the GeneRacer 3' RACE primer (Invitrogen) (GCTGTCAACGATACGCTACGTAACGGCATGACAGTG), or the nematode SL1 sequence (GGTTTAATTACCCAAGTTTGAG) were used with specific primers. Secondary PCRs were carried out using nested primers and 2% of the primary PCR product. Positive PCR products were cloned and sequenced.

BAC-end sequence analysis

The B. malayi BAC-end sequence dataset was compared to the C. elegans proteome in Wormpep. Significant matches were filtered, and BAC clones having matches on both ends retained. The chromosomal position of the C. elegans genes was determined from [32].

Declarations

Acknowledgements

We thank the Filarial Genome Project for the B. malayi BAC library and clones, Yvonne Harcus, Janice Murray, William Gregory, and Rick Maizels for B. malayi materials, Jen Daub and Claire Whitton for BAC-end analysis, Dan Lawson for help with C. elegans genome queries, and New England BioLabs for reagents. Funding for this work was provided by the Medical Research Council. We acknowledge the support and hard work of sequencing team 14 at the Sanger Institute.

Authors’ Affiliations

(1)
Institute of Cell, Animal and Population Biology, University of Edinburgh
(2)
Pathogen Sequencing Unit, The Sanger Institute, Wellcome Trust Genome Campus
(3)
Genome Sequence Centre, British Columbia Cancer Research Centre

References

  1. Hentschel CC, Birnstiel ML: The organization and expression of histone gene families. Cell. 1981, 25: 301-313.PubMedView ArticleGoogle Scholar
  2. Ferrier DE, Holland PW: Ancient origin of the Hox gene cluster. Nat Rev Genet. 2001, 2: 33-38. 10.1038/35047605.PubMedView ArticleGoogle Scholar
  3. Litman GW, Rast JP, Shamblott MJ, Haire RN, Hulst M, Roess W, Litman RT, Hinds-Frey KR, Zilch A, Amemiya CT: Phylogenetic diversification of immunoglobulin genes and the antibody repertoire. Mol Biol Evol. 1993, 10: 60-72.PubMedGoogle Scholar
  4. Ohta Y, Okamura K, McKinney EC, Bartl S, Hashimoto K, Flajnik MF: Primitive synteny of vertebrate major histocompatibility complex class I and class II genes. Proc Natl Acad Sci USA. 2000, 97: 4712-4717. 10.1073/pnas.97.9.4712.PubMedPubMed CentralView ArticleGoogle Scholar
  5. Ranz JM, Casals F, Ruiz A: How malleable is the eukaryotic genome? Extreme rate of chromosomal rearrangement in the genus Drosophila. Genome Res. 2001, 11: 230-239. 10.1101/gr.162901.PubMedPubMed CentralView ArticleGoogle Scholar
  6. Coghlan A, Wolfe KH: Fourfold faster rate of genome rearrangement in nematodes than in Drosophila. Genome Res. 2002, 12: 857-867. 10.1101/gr.172702.PubMedPubMed CentralView ArticleGoogle Scholar
  7. O'Brien SJ, Menotti-Raymond M, Murphy WJ, Nash WG, Wienberg J, Stanyon R, Copeland NG, Jenkins NA, Womack JE, Marshall Graves JA: The promise of comparative genomics in mammals. Science. 1999, 286: 458-462. 10.1126/science.286.5439.458.PubMedView ArticleGoogle Scholar
  8. Fulton RE, Salasek ML, DuTeau NM, Black WCT: SSCP analysis of cDNA markers provides a dense linkage map of the Aedes aegypti genome. Genetics. 2001, 158: 715-726.PubMedPubMed CentralGoogle Scholar
  9. Kent WJ, Zahler AM: Conservation, regulation, synteny, and introns in a large-scale C. briggsae-C. elegans genomic alignment. Genome Res. 2000, 10: 1115-1125. 10.1101/gr.10.8.1115.PubMedView ArticleGoogle Scholar
  10. Caceres M, Ranz JM, Barbadilla A, Long M, Ruiz A: Generation of a widespread Drosophila inversion by a transposable element. Science. 1999, 285: 415-418. 10.1126/science.285.5426.415.PubMedView ArticleGoogle Scholar
  11. Caceres M, Puig M, Ruiz A: Molecular characterization of two natural hotspots in the Drosophila buzzatii genome induced by transposon insertions. Genome Res. 2001, 11: 1353-1364. 10.1101/gr.174001.PubMedPubMed CentralView ArticleGoogle Scholar
  12. Thomas WK, Wilson AC: Mode and tempo of molecular evolution in the nematode caenorhabditis: cytochrome oxidase II and calmodulin sequences. Genetics. 1991, 128: 269-279.PubMedPubMed CentralGoogle Scholar
  13. The C. elegans Sequencing Consortium: Genome sequence of the nematode C. elegans: a platform for investigating biology. Science. 1998, 282: 2012-2018. 10.1126/science.282.5396.2012.View ArticleGoogle Scholar
  14. Vanfleteren JR, Van de Peer Y, Blaxter ML, Tweedie SA, Trotman C, Lu L, Van Hauwaert ML, Moens L: Molecular genealogy of some nematode taxa as based on cytochrome c and globin amino acid sequences. Mol Phylogenet Evol. 1994, 3: 92-101. 10.1006/mpev.1994.1012.PubMedView ArticleGoogle Scholar
  15. McReynolds LA, DeSimone SM, Williams SA: Cloning and comparison of repeated DNA sequences from the human filarial parasite Brugia malayi and the animal parasite Brugia pahangi. Proc Natl Acad Sci USA. 1986, 83: 797-801.PubMedPubMed CentralView ArticleGoogle Scholar
  16. Blaxter M, Daub J, Guiliano DB, Parkinson J, Whitton C, Project FG: The Brugia malayigenome project: expressed sequence tags and gene discovery. Trans Roy Soc Trop Med Hyg. 2001, Google Scholar
  17. Williams SA, Lizotte-Waniewski MR, Foster J, Guiliano D, Daub J, Scott AL, Slatko B, Blaxter ML: The filarial genome project: analysis of the nuclear, mitochondrial and endosymbiont genomes of Brugia malayi. Int J Parasitol. 2000, 30: 411-419. 10.1016/S0020-7519(00)00014-X.PubMedView ArticleGoogle Scholar
  18. Meyer BJ: Sex determination and X chromosome dosage compensation. In C. elegans II. Edited by: Riddle DL, Blumenthal T, Meyer BJ, Priess JR. 1997, Plainview, New York: Cold Spring Harbor Laboratory Press, 209-240.Google Scholar
  19. Sakaguchi Y, Tada I, Ash LR, Aoki Y: Karyotypes of Brugia pahangi and Brugia malayi (Nematoda: Filaroidea). J Parasitol. 1983, 69: 1090-1093.PubMedView ArticleGoogle Scholar
  20. Pastrana DV, Raghavan N, FitzGerald P, Eisinger SW, Metz C, Bucala R, Schleimer RP, Bickel C, Scott AL: Filarial nematode parasites secrete a homologue of the human cytokine macrophage migration inhibitory factor. Infect Immun. 1998, 66: 5955-5963.PubMedPubMed CentralGoogle Scholar
  21. Stec I, Wright TJ, van Ommen GJ, de Boer PA, van Haeringen A, Moorman AF, Altherr MR, den Dunnen JT: WHSC1, a 90 kb SET domain-containing gene, expressed in early development and homologous to a Drosophila dysmorphy gene maps in the Wolf-Hirschhorn syndrome critical region and is fused to IgH in t(4;14) multiple myeloma. Hum Mol Genet. 1998, 7: 1071-1082. 10.1093/hmg/7.7.1071.PubMedView ArticleGoogle Scholar
  22. Stec I, Nagl SB, van Ommen GJ, den Dunnen JT: The PWWP domain: a potential protein-protein interaction domain in nuclear proteins influencing differentiation?. FEBS Lett. 2000, 473: 1-5. 10.1016/S0014-5793(00)01449-6.PubMedView ArticleGoogle Scholar
  23. Nishihira J: Macrophage migration inhibitory factor (MIF): its essential role in the immune system and cell growth. J Interferon Cytokine Res. 2000, 20: 751-762. 10.1089/10799900050151012.PubMedView ArticleGoogle Scholar
  24. Falcone FH, Loke P, Zang X, MacDonald AS, Maizels RM, Allen JE: A Brugia malayi homolog of macrophage migration inhibitory factor reveals an important link between macrophages and eosinophil recruitment during nematode infection. J Immunol. 2001, 167: 5348-5354.PubMedView ArticleGoogle Scholar
  25. Marson AL, Tarr DEK, Scott AL: Macrophage migration inhibitory (mif) transcription is significantly elevated in Caenorhabditis elegans dauer larvae. Gene. 2001, 278: 53-62. 10.1016/S0378-1119(01)00706-5.PubMedView ArticleGoogle Scholar
  26. Kleemann R, Rorsman H, Rosengren E, Mischke R, Mai NT, Bernhagen J: Dissection of the enzymatic and immunologic functions of macrophage migration inhibitory factor. Full immunologic activity of N-terminally truncated mutants. Eur J Biochem. 2000, 267: 7183-7193. 10.1046/j.1432-1327.2000.01823.x.PubMedView ArticleGoogle Scholar
  27. Xue Y, Canman JC, Lee CS, Nie Z, Yang D, Moreno GT, Young MK, Salmon ED, Wang W: The human SWI/SNF-B chromatin-remodeling complex is related to yeast rsc and localizes at kinetochores of mitotic chromosomes. Proc Natl Acad Sci USA. 2000, 97: 13015-13020. 10.1073/pnas.240208597.PubMedPubMed CentralView ArticleGoogle Scholar
  28. Nicolas RH, Goodwin GH: Molecular cloning of polybromo, a nuclear protein containing multiple domains including five bromodomains, a truncated HMG-box, and two repeats of a novel domain. Gene. 1996, 175: 233-240. 10.1016/0378-1119(96)82845-9.PubMedView ArticleGoogle Scholar
  29. Altschul SF, Koonin EV: Iterated profile searches with PSI-BLAST-a tool for discovery in protein databases. Trends Biochem Sci. 1998, 23: 444-447. 10.1016/S0968-0004(98)01298-5.PubMedView ArticleGoogle Scholar
  30. Deiss LP, Feinstein E, Berissi H, Cohen O, Kimchi A: Identification of a novel serine/threonine kinase and a novel 15-kD protein as potential mediators of the gamma interferon-induced cell death. Genes Dev. 1995, 9: 15-30.PubMedView ArticleGoogle Scholar
  31. Wormpep. [http://www.sanger.ac.uk/Projects/C_elegans/wormpep]
  32. WormBase. [http://www.wormbase.org/]
  33. Friedman R, Hughes AL: Gene duplication and the structure of eukaryotic genomes. Genome Res. 2001, 11: 373-381. 10.1101/gr.155801.PubMedPubMed CentralView ArticleGoogle Scholar
  34. Lespinet O, Wolf YI, Koonin EV, Aravind L: The role of lineage-specific gene family expansion in the evolution of eukaryotes. Genome Res. 2002, 12: 1048-1059. 10.1101/gr.174302.PubMedPubMed CentralView ArticleGoogle Scholar
  35. Blaxter ML: Genes and genomes of Necator americanus and related hookworms. Int J Parasitol. 2000, 30: 347-355. 10.1016/S0020-7519(99)00198-8.PubMedView ArticleGoogle Scholar
  36. Walton AC: Some parasites and their chromosomes. J Parasitol. 1959, 45: 1-20.PubMedView ArticleGoogle Scholar
  37. Blaxter ML, De Ley P, Garey JR, Liu LX, Scheldeman P, Vierstraete A, Vanfleteren JR, Mackey LY, Dorris M, Frisse LM, et al: A molecular evolutionary framework for the phylum Nematoda. Nature. 1998, 392: 71-75. 10.1038/32160.PubMedView ArticleGoogle Scholar
  38. Foster JM, Kamal IH, Daub J, Swan MC, Ingram JR, Ganatra M, Ware J, Guiliano D, Aboobaker A, Moran L, et al: Hybridization to high-density filter arrays of a Brugia malayi BAC library with biotinylated oligonucleotides and PCR products. Biotechniques. 2001, 30: 1216-1218.PubMedGoogle Scholar
  39. Parkinson J, Whitton C, Guiliano D, Daub J, Blaxter ML: 200,000 nematode ESTs on the net. Trends Parasitol. 2001, 17: 394-396. 10.1016/S1471-4922(01)01954-7.PubMedView ArticleGoogle Scholar
  40. Zang X, Yazdanbakhsh M, Jiang H, Kanost MR, Maizels RM: A novel serpin expressed by blood-borne microfilariae of the parasitic nematode Brugia malayi inhibits human neutrophil serine proteinases. Blood. 1999, 94: 1418-1428.PubMedGoogle Scholar
  41. Maina CV, Grandea AG, Tuyen LTK, Asikin N, Williams SA, McReynolds LA: Dirofilaria immitis: Genomic complexity and characterisation of a structural gene. In Molecular Paradigms for Eradicating Helminthic Parasites. Edited by: MacInnis AJ. 1987, Alan Liss: New York, 193-204.Google Scholar
  42. Reboul J, Vaglio P, Tzellas N, Thierry-Mieg N, Moore T, Jackson C, Shin IT, Kohara Y, Thierry-Mieg D, Thierry-Mieg J, et al: Open-reading-frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nat Genet. 2001, 27: 332-336. 10.1038/85913.PubMedView ArticleGoogle Scholar
  43. Brunner B, Todt T, Lenzner S, Stout K, Schulz U, Ropers HH, Kalscheuer VM: Genomic structure and comparative analysis of nine Fugu genes: conservation of synteny with human chromosome Xp22.2-p22.1. Genome Res. 1999, 9: 437-448.PubMedPubMed CentralGoogle Scholar
  44. Hamer L, Pan H, Adachi K, Orbach MJ, Page A, Ramamurthy L, Woessner JP: Regions of microsynteny in Magnaporthe grisea and Neurospora crassa. Fungal Genet Biol. 2001, 33: 137-143. 10.1006/fgbi.2001.1286.PubMedView ArticleGoogle Scholar
  45. Huynen MA, Snel B, Bork P: Inversions and the dynamics of eukaryotic gene order. Trends Genet. 2001, 17: 304-306. 10.1016/S0168-9525(01)02302-2.PubMedView ArticleGoogle Scholar
  46. Blumenthal T, Steward K: RNA processing and gene structure. In C. elegans II. Edited by: Riddle DL, Blumenthal T, Meyer BJ, Priess JR. 1997, Plainview, New York: Cold Spring Harbor Laboratory Press, 117-146.Google Scholar
  47. Blumenthal T, Evans D, Link CD, Guffanti A, Lawson D, Thierry-Mieg J, Thierry-Mieg D, Chiu WL, Duke K, Kiraly M, Kim SK: A global analysis of Caenorhabditis elegans operons. Nature. 2002, 417: 851-854. 10.1038/nature00831.PubMedView ArticleGoogle Scholar
  48. Maeda I, Kohara Y, Yamamoto M, Sugimoto A: Large-scale analysis of gene function in Caenorhabditis elegans by high-throughput RNAi. Curr Biol. 2001, 11: 171-176. 10.1016/S0960-9822(01)00052-5.PubMedView ArticleGoogle Scholar
  49. Fraser AG, Kamath RS, Zipperlen P, Martinez-Campos M, Sohrmann M, Ahringer J: Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature. 2000, 408: 325-330. 10.1038/35042517.PubMedView ArticleGoogle Scholar
  50. Grant D, Cregan P, Shoemaker RC: Genome organization in dicots: genome duplication in Arabidopsis and synteny between soybean and Arabidopsis. Proc Natl Acad Sci USA. 2000, 97: 4168-4173. 10.1073/pnas.070430597.PubMedPubMed CentralView ArticleGoogle Scholar
  51. Ku HM, Vision T, Liu J, Tanksley SD: Comparing sequenced segments of the tomato and Arabidopsis genomes: large-scale duplication followed by selective gene loss creates a network of synteny. Proc Natl Acad Sci USA. 2000, 97: 9121-9126. 10.1073/pnas.160271297.PubMedPubMed CentralView ArticleGoogle Scholar
  52. Guiliano D, Ganatra M, Ware J, Parrot J, Daub J, Moran L, Brennecke H, Foster JM, Supali T, Blaxter M, et al: Chemiluminescent detection of sequential DNA hybridizations to high- density, filter-arrayed cDNA libraries: a subtraction method for novel gene discovery. Biotechniques. 1999, 27: 146-152.PubMedGoogle Scholar
  53. End sequencing protocol. [http://www.sanger.ac.uk/Teams/Team51/PACBACPrep.shtml]
  54. Organization of the Gap4 manual. [http://www.mrc-lmb.cam.ac.uk/pubseq/manual/gap4_unix_1.html]
  55. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local alignment search tool. J Mol Biol. 1990, 215: 403-410. 10.1006/jmbi.1990.9999.PubMedView ArticleGoogle Scholar
  56. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997, 25: 3389-3402. 10.1093/nar/25.17.3389.PubMedPubMed CentralView ArticleGoogle Scholar
  57. Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream MA, Barrell B: Artemis: sequence visualization and annotation. Bioinformatics. 2000, 16: 944-945. 10.1093/bioinformatics/16.10.944.PubMedView ArticleGoogle Scholar
  58. Bateman A, Birney E, Durbin R, Eddy SR, Howe KL, Sonnhammer EL: The Pfam protein families database. Nucleic Acids Res. 2000, 28: 263-266. 10.1093/nar/28.1.263.PubMedPubMed CentralView ArticleGoogle Scholar
  59. Nakai K, Kanehisa M: A knowledge base for predicting protein localization sites in eukaryotic cells. Genomics. 1992, 14: 897-911.PubMedView ArticleGoogle Scholar
  60. NemBase. [http://www.nematodes.org/]
  61. Lizotte-Waniewski M, Tawe W, Guiliano DB, Lu W, Liu J, Williams SA, Lustigman S: Identification of potential vaccine and drug target candidates by expressed sequence tag analysis and immunoscreening of Onchocerca volvulus larval cDNA libraries. Infect Immun. 2000, 68: 3491-3501. 10.1128/IAI.68.6.3491-3501.2000.PubMedPubMed CentralView ArticleGoogle Scholar

Copyright

© Guiliano et al., licensee BioMed Central Ltd 2002